close

Enter

Log in using OpenID

Pierdomenico et al definitive revision

embedDownload
Lipids:
MicroRNA-181b regulates ALX/FPR2
expression and proresolution signaling in
human macrophages
Anna Maria Pierdomenico, Antonio Recchiuti,
Felice Simiele, Marilina Codagnone, Veronica
Cecilia Mari, Giovanni Davi and Mario
Romano
J. Biol. Chem. published online December 11, 2014
Find articles, minireviews, Reflections and Classics on similar topics on the JBC Affinity Sites.
Alerts:
• When this article is cited
• When a correction for this article is posted
Click here to choose from all of JBC's e-mail alerts
This article cites 0 references, 0 of which can be accessed free at
http://www.jbc.org/content/early/2014/12/11/jbc.M114.592352.full.html#ref-list-1
Downloaded from http://www.jbc.org/ by guest on December 29, 2014
Access the most updated version of this article at doi: 10.1074/jbc.M114.592352
JBC Papers in Press. Published on December 11, 2014 as Manuscript M114.592352
The latest version is at http://www.jbc.org/cgi/doi/10.1074/jbc.M114.592352
ALX/FPR2 regulation by miRNA-181b
microRNA-181b Regulates ALX/FPR2 Expression and Proresolution Signaling in Human Macrophages*
Anna Maria Pierdomenico1,3, Antonio Recchiuti2,3, Felice Simiele2,3, Marilina Codagnone2,3, Veronica
Cecilia Mari2,3,Giovanni Davì1,3 and Mario Romano 2,3
1
From the Department of Medicine and Aging Sciences, 2 Department of Experimental and Clinical Sciences,
“G. d’Annunzio” University, Chieti, Italy; 3Center of Excellence on Aging “G. D’Annunzio” University
Foundation, Chieti, Italy
*Running Title: ALX/FPR2 regulation by miRNA-181b
To whom correspondence should be addressed: Mario Romano, M.D., G. D’Annunzio University, Centre of
Excellence on Aging, Via Luigi Polacchi 11/13, 66013 Chieti, Italy, Phone and Fax: +39 0871541475, email: mromano@unich.it
Keywords: eicosanoids; microRNA; G-protein coupled receptor (GPCR); inflammation; gene regulation;
macrophage; lipid mediators
(0.01-10 nM) stimulated phagocytic activity of
macrophages. These results unravel novel
regulatory mechanisms of ALX/FPR2 expression
and ligand-evoked macrophages pro-resolutive
responses mediated by miR-181b, thus
uncovering novel components of the endogenous
inflammation resolution circuits.
Resolution of inflammation is an active process
that prevents host damage and is essential for
restoring tissue homeostasis. Several cellular and
molecular processes orchestrate the return to
homeostasis after an acute inflammatory challenge,
by limiting polymorphonuclear neutrophils (PMN)
infiltration and promoting their removal via non
phlogistic phagocytosis by macrophages (MФs)
(i.e., efferocytosis) (1, 2). Endogenous chemical
mediators derived from essential polyunsaturated
fatty acids play key roles in acute inflammation and
resolution via specific G-protein coupled receptors
(GPCRs) (3). Contrary to the arachidonic acid
(AA)-derived leukotrienes (LT), which act on
cognate GPCRs to enhance PMN recruitment,
infiltration, and activation, lipoxins (LX) are
autacoid
bestowing
anti-inflammatory
and
proresolutive bioactions (4). LXA4 (5, 6, 15Strihydroxy-7, 9, 11, 13-trans-11-cis-eicosatetraenoic
acid) is biosynthesized from AA (5) during a lipid
mediator
class
switch,
characteristic
of
inflammation
resolution
(6),
through
a
multienzymatic pathway involving 5-lipoxygenase
(LO) and 12-LO or 15-LO (7-9). In addition, aspirin
initiates the biosynthesis of C15 epimers of LX,
namely 15-epi-LX through the acetylation of
cyclooxygenase (COX) 2 (10). Notably, 15-epiLXA4 (5, 6, 15R-trihydroxy-7, 9, 11, 13-trans-11cis-eicosatetraenoic acid) proved to be as efficacious
as aspirin and dexamethasone in reducing acute
ABSTRACT
Regulatory mechanisms of ALX/FPR2, the
lipoxin (LX)A4
receptor, expression have
considerable
relevance
in
inflammation
resolution. Since microRNAs (miRs) are
emerging as key players in inflammation
resolution, here we examined microRNAmediated regulation of ALX/FPR2 expression.
By matching data from bioinformatic algorithms,
we found 27 miRs predicted to bind the 3’UTR of
ALX/FPR2. Among these, we selected miR-181b
because of its link with inflammation. Using a
luciferase reporter system, we assessed miR-181b
binding to ALX/FPR2 3’ UTR. Consistent with
this, miR-181b overexpression in human
macrophages
significantly
downregulated
ALX/FPR2 protein levels (- 25 %), whereas miR181b knock-down gave a significant increase in
ALX/FPR2 (+ 60 %). miR-181b levels decreased
during monocyte to macrophage differentiation
(- 50 %), while ALX/FPR2 expression increased
significantly (+ 60 %). miR-181b overexpression
blunted LXA4- (0.1-10 nM) and Resolvin D11
Copyright 2014 by The American Society for Biochemistry and Molecular Biology, Inc.
Downloaded from http://www.jbc.org/ by guest on December 29, 2014
Background: The ALX/FPR2 receptor recognizes
the proresolution mediators lipoxin (LX)A4 and
resolvin (Rv)D1, thus modulating immune
responses.
Results: miR-181b binds to the 3’ UTR of the
ALX/FPR2 gene, regulating its expression. mir181b
blunted
LXA4and
RvD1-induced
macrophage phagocytosis.
Conclusions: miR-181b controls ALX/FPR2
expression. This mechanism modulates proresolution signals in macrophages.
Significance: miR regulation of ALX/FPR2
expression may be exploited for innovative antiinflammatory strategies.
ALX/FPR2 regulation by miRNA-181b
identified in mouse inflammatory exudates. For
instance, miR-21, miR-146b, miR-219 miR-208a,
are regulated by RvD1 during self-limited
inflammation (33) in a GPCR-dependent manner
(16). In addition, Fredman et al. (34) compared
microRNA expression in self-limited and delayed
zymosan-induced inflammation, finding that the
RvD1-regulated mir-208 was expressed at a lower
extent in exudates from delayed resolution
inflammation. Moreover, Li et al (35) found that
miR-466l
is
temporally
regulated
during
inflammation resolution and enhances resolution by
increasing RvD1 levels in mouse exudateinfiltrating leukocytes.
In humans, the LPS- and RvD1-regulated miR-21
controls
the
inflammatory
response
by
downregulating the translation of tumor suppressor
programmed cell death 4 protein, an inhibitor of
interleukin (IL)-10 production (36). Furthermore,
the RvD1-regulated miR-219-5p reduces 5-LO
expression and LTB4 production in zymosaninduced peritonitis (33), while let-7c mediates the
antifibrotic actions of LXA4 in kidney fibrosis (37).
Whether miRs control ALX/FPR2 expression as
part of a more general host response during
inflammation and resolution remains to be
determined.
Herein, we provide the first evidence that miR181b directly binds ALX/FPR2 3’UTR and controls
ALX/FPR2 protein expression. This mechanism has
an impact on functional responses of human
macrophages exposed to pro-resolution ALX/FPR2
agonists. Thus, miR-181b represents the first
identified microRNA that can regulate the resolution
process by targeting a pro-resolving GPCR.
EXPERIMENTAL PROCEDURES
Materials- Lipoxin A4 (5S, 6R, 15S-trihydroxy7E, 9E, 11Z, 13E-eicosatetraenoic acid), purchased
from Calbiochem, (Millipore, Billerica, MA, USA)
and resolvin D1 (7S, 8R, 17S-trihydroxy-4Z, 9E,
11E, 13Z, 15E, 19Z-docosahexaenoic acid), from
Cayman Chemicals (Ann Arbor, MI, USA), were
stored at -80 ºC in ethanol, dissolved in the
appropriate aqueous buffer immediately before each
experiment, and kept in the dark until added to cells.
Growth media, fetal bovine serum (FBS), and
supplements were from Lonza (Walkersville, MD,
USA), unless otherwise indicated.
In silico analysis- In silico prediction analysis of
human microRNA binding to ALX/FPR2 3’UTR
was carried out using two bioinformatic algorithms,
Target scan human (http://www.targetscan.org/) and
2
Downloaded from http://www.jbc.org/ by guest on December 29, 2014
inflammation in murine models (11) and to mediate
anti-inflammatory actions of low-dose aspirin in
humans (12).
The potent pro resolution bioactions of LXA4 and
15-epi-LXA4 occur via the activation of a specific
GPCR termed lipoxin A4 (ALX) receptor/formyl
peptide receptor (FPR)2 (13), which signals to
inhibit NF-κB activation, stop leukocyte diapedesis,
and enhance efferocytosis (9, 14). ALX/FPR2 also
recognizes additional endogenous immunoresolving
lipid and peptide ligands, such as the omega-3derived resolvin (Rv) D1 (15, 16) and the
glucorticoid-induced protein Annexin (Anx)A1 and
its derived peptides (11), signifying this receptor as
critical component of innate pro-resolution
pathways. The important role of ALX/FPR2 in
controlling immune responses stems from studies
with genetically modified mice as well as from
human studies. In particular, myeloid-driven
overexpression of human ALX/FPR2 in mice
resulted in reduced PMN infiltration during acute
peritonitis and left-shifting in dose-response to its
ligands (14,16), whereas ALX/FPR2 KO mice
present an impaired resolution phenotype (16-18).
Notably, in humans subjected to cantharidininduced skin blisters and treated with low dose
aspirin, levels of ALX/FPR2 and 15-epi-LXA4 in
exudate leukocytes and fluids predict the outcome
of
acute
inflammation
(19).
Impairment of ALX/FPR2 and pro-resolution
agonists in human diseases characterized by non
resolving inflammation is well documented. For
instance, subjects with severe asthma have an
imbalance in the LX-ALX/FPR2 axis, with impaired
biosynthesis of LX (20, 21) and increased levels of
ALX/FPR2 on natural killer cells (22). Similarly,
LX and RvD1 biosynthesis or AnxA1 expression
are significantly altered in patients suffering from
cystic fibrosis (23-26), obesity (27), and
atherosclerosis
(28).
Notably,
therapeutic
administration of ALX/FPR2 pro-resolution
agonists in experimental models reverts disease
progression and outcome, making the elucidation of
the regulatory mechanisms of ALX/FPR2
expression and functions of strong interest. Along
these lines, we recently identified a human
ALX/FPR2 promoter sequence as well as genetic
and epigenetic regulatory mechanisms of
ALX/FPR2 transcription (29).
Accruing evidence demonstrates that microRNAs
(miRs) (30-32), which act as fine tuners of gene
output in cells, have important roles in resolution
circuits and are part of the mechanisms of actions of
LX and Rv. Several microRNAs have been recently
ALX/FPR2 regulation by miRNA-181b
reagent solution (200 µl) was added to macrophages
kept in 1.8 mL of RPMI medium as above.
ALX/FPR2 3’ UTR cloning- ALX/FPR2 3’ UTR
was cloned in the psiCHECK-2 vector (Promega,
Milan, Italy) (ALX-psiCHECK-2) using the
following
primers:
5’
GGATGGGGTCAGGGATATTTT 3’ (forward)
and 5’ CACTGGTGAATTTTTCTGAATATT 3’
(reverse) with the addition of consensus sequences
for Not I and XhoI (both from New England
Biolabs, Ipswich, MA, USA). PCR thermal profile
consisted of 3 min at 94°C; 35 cycles (30 s at 94 °C;
30 s at 58 °C; 50 s at 72 °C) and 5 min at 72 °C.
Following NotI/XhoI digestion at 37°C over night
and ligation (T4 DNA ligase, Promega), plasmids
were sequenced to confirm the correctness of
cloning.
3’UTR Luciferase Reporter Assay- Breast cancer
MDA-MB-231
cells,
grown
in
DMEM
supplemented with 10 % FBS, 1 % L-Gln and PS,
were co-transfected with ALX-psiCHECK-2 and
miR-181b-TW or empty TW plasmid as a control
(1.5 µg each) using Lipofectamin 2000 (12 µL,
LifeTechnologies) according to the manufacturer’s
protocol. Twenty four hour post transfection, cells
were lysed and the luciferase activity was
determined as in ref. (29).
miRNA extraction and real time PCR analysismiRNA-enriched fractions were extracted using a
silica-based spin column system (Norgen, Thorold,
ON, Canada), UV-quantified using a NanoDrop
spectrophotometer (Thermo Scientific, Waltham,
MA, USA), and reverse transcribed with the
miScript II RT Kit (Qiagen). Real time PCR
analyses were carried out with 1.5 ng of cDNA
using specific primers (miScript Primer Assays,
Qiagen) and a SYBR Green master mix (also from
Qiagen) with a 7900HT Fast thermal cycler
(LifeTechnologies). Relative abundance of miR181b was determined by the 2-ΔCt method (39) and
the small nucleolar RNA (RNU) 1A was used to
normalize input cDNA.
Flow Cytometry- For flow cytometric analysis of
ALX/FPR2 protein, cells (1 x 106/sample) were
incubated with 0.5 µg of anti-ALX/FPR2 primary
antibody (Genovac/Aldevron, Freiburg, Germany)
and Alexa Fluor 647-labeled secondary antibody
(Life Technologies). Analyses were carried out
using a FACS Calibur flow cytometer equipped
with the CellQuest software (BD Bioscience, Milan,
Italy).
Zymosan phagocytosis by macrophages- Human
PBMC-derived macrophages were transfected with
1.5 µg of miR-181b-TW or empty TW vector, using
3
Downloaded from http://www.jbc.org/ by guest on December 29, 2014
microRNA.org
(http://www.microrna.org/microrna/home.do).
Monocyte
isolation
and
macrophage
differentiation- Monocytes were isolated from
peripheral blood of healthy subjects as follows.
Twenty five mL of blood, collected in sodium
citrate (0.9 %), were centrifuged (15 min, 150 x g
w/o breaks and accelerator). Platelet rich plasma
was removed and the remaining was diluted with
Ca2+/Mg2+ free Dulbecco’s phosphate buffered
saline (DPBS) (10 mL) plus 6 % dextran (8 mL) and
allowed to sediment for 15 min. The upper layer
was placed over 10 mL of Histopaque-1077 Ficoll
(Sigma Aldrich, Milan, Italy) and centrifuged (430 x
g for 30 min w/o breaks and accelerator). Peripheral
blood mononuclear cells (PBMC)-containing buffy
coat was gently aspirated, washed twice with
Ca2+/Mg2+ free DPBS and cells counted. Cells (12 x
106) were suspended with serum-free RPMI and
allowed to adhere on polystyrene cell culture plates
for 1-2 h. Non adherent cells were aspirated,
whereas adherent monocytes were gently washed
three times with DPBS. Monocyte purity was
determined by flow cytometry using an anti-CD-14
antibody (TÜK4 clone, Miltenyi Biotech, Calderara
di Reno, Bologna, Italy). MФ differentiation was
carried out as in ref. (15) by maintaining monocytes
in RPMI supplemented with 10 % FBS, 1 % LGlutamine (Gln), 1 % penicillin/streptomycin (PS),
and GM-CSF (10 ng/µl, Prospec, East Brunswick,
NJ, USA) for 7 days.
Transfection of macrophages with miR-181b
expressing plasmid- Macrophages (1-2 x 106
cells/well) were transfected with empty vector or
miR-181b-expressing TW (miR-181b-TW), cloned
as previously reported by Visone et al. (38), using
Jet-Pei macrophages (Polyplus Transfection,
Illkirch, France). Briefly, 1.5 µg of plasmids were
diluted with 100 µl of NaCl (0.9 %) and mixed with
3 µl of the JetPei reagent diluted with 100 µl of
NaCl. After 20 min at room temperature (r.t.), the
DNA-JetPei mixture was added to macrophages
kept in 1.8 mL of RPMI supplemented with 10 %
FBS, 1 % L-Gln and 1 % PS.
Transfection of macrophages with miR-181b
inhibitor- Human macrophages were transfected
with 10 nM of miR-181b inhibitor (miScript,
Qiagen, Milan, Italy) or non targeting negative
control (NC) single strain RNA (also from Qiagen)
using the INTERFERin transfection reagent
(Polyplus Transfection). Briefly, miR-181b inhibitor
and NC were diluted with 200 µl of Optimem (Life
Technologies, Monza, Italy) and combined with 4 µl
of INTERFERin. After 10 min at r.t., the RNA-
ALX/FPR2 regulation by miRNA-181b
regulate its expression is relevant. Since miRs are
important modulators of gene/protein expression
(41), we sought to identify miRs that may regulate
ALX/FPR2 expression. To this end, we searched for
predicted binding sites for human miRs within the
3’ UTR of ALX/FPR2 by matching data from two
bioinformatic algorithms, namely Target scan
human and microRNA.org, which rely on different
criteria for prediction and ranking, e.g., stringent or
loose Watson-Crick pairing of the seed region of
miRNAs, site context and accessibility and
sequence conservation (42). Among the 27 miRs
(Table 1) predicted by both algorithms to bind the
3’UTR of ALX/FPR2, we selected miR-181b as
primary candidate, since it is strongly expressed in
lymphocytes (36) and it appears to be related to
inflammation (43-45).
Analysis of miR-181b binding to ALX/FPR2 3’
UTR- In order to validate results from bioinformatic
predictions, we examined miR-181b direct binding
to ALX/FPR2 3’UTR. To this end, we generated a
reporter construct containing the renilla luciferase
gene 684 bp upstream the 3’ UTRs of the
ALX/FPR2 mRNA, encompassing the putative
miR-181b target sites (ALX-psiCHECK-2). This
was co-transfected into MDA-MB-231 cells with a
miR-181b-expressing plasmid (miR-181b-TW).
The miR-181b sequence cloned in this plasmid is
conserved within the two known miR-181b
encoding genes (Fig. 1). Twenty four hour post
transfection, luciferase activity was measured. We
observed a significant (~ 70 %; P = 0.006) reduction
in luciferase activity in MDA-MB-231 cells coexpressing miR-181b-TW and ALX-psiCHECK-2
compared to cells transiently transfected with the
empty TW vector together with ALX-psiCHECK-2
(Fig. 2). These results establish that miR-181b binds
to the 3’UTR of ALX/FPR2.
miR-181b controls ALX/FPR2 surface expression
in monocytes/macrophages- Given the direct
binding of miR-181b to the ALX/FPR2 3’UTR, we
tested the effect of miR-181b on ALX/FPR2 surface
expression.
To
this
end,
we
selected
monocyte/macrophages as cellular system, because
they express both miR-181b and ALX/FPR2 and
play key roles in inflammation-resolution. As shown
in Fig. 3A, transfection of human monocyte-derived
MФs with the miR-181b-TW plasmid, resulted in a
∼ 4 fold increase in miR-181b levels 24 h post
transfection. This was associated with a ~ 25 % (P =
0.0001) reduction in ALX/FPR2 protein (Fig. 3B),
which is in line with the reported impact of
microRNAs on protein output (32), as well as of
miR-181b on other validated target genes such as
RESULTS
Selection of miRs that putatively bind to
ALX/FPR2 3’UTR- ALX/FPR2 has pivotal roles in
the resolution of inflammation as well as in the
outcome of acute inflammatory reactions (12).
Therefore, the elucidation of the mechanisms that
4
Downloaded from http://www.jbc.org/ by guest on December 29, 2014
Jet-Pei Macrophages (Polyplus TransfectionTM), as
reported above, and seeded in 24 well plates (2.5-5
x 105 cells/well) 48 h post transfection. The
following day, cells were washed twice with DBPS
and treated with LXA4, RvD1, or vehicle (0.01 %
EtOH) in DPBS. After 15 min at 37 ºC, fluorescein
isothiocyanate (FITC)-labeled serum opsonized
zymosan (Zym) A (from S. cerevisiae) particles (15
ng/well) were added to cells for 30 min at 37 °C.
Macrophages were then washed twice with DPBS,
added of 100 µL of trypan blue (0.03 % in DPBS) to
quench fluorescence from extracellular FITC-Zym,
and phagocytosis was assessed by measuring
fluorescence on a SpectraMAX Gemini XS plate
reader (Molecular Devices, Sunnyvale, California)
as in ref. (40).
PMN isolation and apoptosis- PMN were isolated
from 25 mL of blood by dextran sedimentation as
reported previously (33). Briefly, after removal of
platelet rich plasma, blood was diluted with
Ca2+/Mg2+ free Dulbecco’s phosphate buffered
saline (DPBS) (10 mL) plus 6 % dextran (8 mL) and
allowed to sediment for 15 min. The upper layer
was placed over 10 mL of Histopaque-1077 Ficoll
(Sigma Aldrich, Milan, Italy) and centrifuged (430 x
g for 30 min w/o breaks and accelerator). PMN-rich
pellet was lysed and PMN isolated as reported (33).
Apoptosis was induced by incubating PMN with
RPMI supplemented with 10 % FBS, 1 % LGlutamine (Gln), 1 % penicillin/streptomycin (PS)
over night. Apoptosis was assessed by trypan blue
exclusion and flow cytometry with Annexin V and
propidium iodide double staining.
TNFα
releaseHuman
PBMC-derived
macrophages were transfected with 1.5 µg of miR181b-TW or empty TW vector and seeded, as
reported above. Cells were exposed to LXA4, RvD1,
or vehicle (0.01 % EtOH) in DPBS at 37 ºC, 15 min
before the addition of Zym (see above). TNF-α
levels in the supernatants were evaluated using a
TNF-α Standard ELISA Development Kit
(Peprotech, London, UK).
Statistical Analysis- Results are reported as
arithmetic mean ± SEM unless otherwise indicated.
Statistical significance was evaluated by the
Student’s T-test with P < 0.05 taken as significant.
ALX/FPR2 regulation by miRNA-181b
Overexpression of miR-181b affects macrophage
antiinflammatory and proresolution responses to
ALX/FPR2 agonists- Next, we sought to determine
whether
miR-181b-mediated
regulation
of
ALX/FPR2 had an impact on agonist-evoked
biological
responses.
Since
macrophage
phagocytosis is the hallmark of resolution and it is
strongly enhanced by pro-resolving lipid mediators,
such as LX and Rv (9, 15, 16), we assessed
phagocytosis of fluorescent–labeled zymosan
particles, which mimics bacterial clearance from
inflamed tissue, by miR-181b overexpressing MΦs
exposed to the ALX/FPR2 agonists LXA4 and
RvD1. miR-181b overexpression per se did not alter
baseline Zym phagocytosis (Fig. 7A). Both LXA4
(0.1-10 nM) and RvD1 (0.1-10 nM) concentrationdependently stimulated FITC-Zym phagocytosis in
mock-transfected MΦs. This response was blunted
in miR-181b-overexpressing cells (Figs. 7B and
7C). We also examined the impact of miR-181b
overexpression on RvD1 regulation of TNF-α
expression as readout of proinflammatory signals.
To this end, MΦs, transfected with TW or miR181b-TW, were exposed to zymosan plus or minus
increasing concentration of RvD1. TNF-α levels
were then assessed by ELISA. Transfection with
miR-181b-TW gave a slight, not statistically
significant reduction in TNF-α release (Fig. 7D).
RvD1 (0.01-10 nM) significantly reduced TNF-α
release by TW-transfected MΦs exposed to
zymosan. This effect was lost in miR-181b
overexpressing cells (Fig. 7E).
Together, these results indicate that the
downregulation of ALX/FPR2 expression by miR181b is associated with suppression of
antiinflammatory, proresolution cellular responses
triggered by endogenous ligands of this receptor.
DISCUSSION
In this study, we identified miR-181b as regulator of
human ALX/FPR2 expression as well as of
ALX/FPR2 agonist-induced proresolution functions
in human macrophages.
The ALX/FPR2 receptor conveys proresolution
signals triggered by a number of endogenous antiinflammatory mediators (8, 9). In vivo and in vitro
data indicate that ALX/FPR2 expression levels
represent per se a determinant of inflammation
resolution, even in the absence of exogenously
added agonists (9, 14). Strikingly, a recent clinical
trial demonstrated safety and effectiveness of a
LXA4 analog in infantile eczema, opening the road
to resolution pharmacology in humans (47). Thus,
5
Downloaded from http://www.jbc.org/ by guest on December 29, 2014
importin-3, COX 2, and insulin growth factor 1
receptor (46). Notably, miR-181b overexpression
reduced ALX/FPR2 levels equally well in
permeabilized (P = 0.016) and non permeabilized
cells (P = 0.0001), indicating that miR-181b
dowregulates ALX/FPR2 expression by acting on
translation, not on trafficking.
To obtain further evidence of a “cause and effect”
relationship between miR-181b and ALX/FPR2, we
transfected human MФs with a miR-181b inhibitor.
Real time PCR analysis showed that miR-181b
levels decreased by ∼ 2.5 fold (P = 0.004) in MФs
transfected with the miR-181b inhibitor (Fig. 4A).
In these cells, ALX/FPR2 protein expression
increased by ∼ 60 % (P = 0.0002) (Fig. 4B).
On the other hand, ALX/FPR2 regulation by mir181b appears to be selective, since the expression of
GPR32, another G-coupled protein receptor
recognized by RvD1 (15) did not change in MФs
transfected with the miR-181b inhibitor (Fig. 4D).
Together, these results establish that ALX/FPR2 is a
direct target of miR-181b.
miR-181b and ALX/FPR2 levels change during
differentiation of monocytes to macrophages- In
order to evaluate the inverse relationship between
miR-181b and ALX/FPR2 expression within a
pathophysiological context, we determined their
levels
during
monocyte
to
macrophage
differentiation, a key cellular event in inflammation
resolution. Relative expression of miR-181b in
peripheral blood monocytes from healthy subjects,
calculated using the 2-ΔCt method with RNU1A as
housekeeping miRNA, was 0.043 ± 0.012 (2-ΔCt).
This significantly decreased to 0.025 ± 0.008
following macrophage differentiation with GM-CSF
for 7 days (P = 0.048) (Fig. 5A). On the contrary,
ALX/FPR2
protein
expression
significantly
increased in MΦs (44.5 ± 4.2 M.F.I.) compared to
monocytes (29.2 ± 1.5 M.F.I.) (P = 0.01) (Fig. 5B).
Thus, miR-181b and ALX/FPR2 displayed an
inverse expression pattern during macrophage
differentiation.
miR-181b regulation by efferocytosis and
exposure to zymosan- To assess the impact of key
events in inflammation and resolution on miR-181
expression, we incubated macrophages with
apoptotic PMN or zymosan and evaluated miR-181b
relative expression after 24 h, 48 h and 72 h by real
time PCR. Coincubation with apoptotic PMN (Fig.
6A) significantly decreased miR-181b expression (P
= 0.011) after 48 h. On the contrary exposure to
zymosan gave a significant increment (P = 0.011)
(Fig. 6B).
ALX/FPR2 regulation by miRNA-181b
mechanism (54). Thus, it is likely that miR-181b is
involved in the regulation of the inflammatory
response in different cells and clinical settings.
Our present data support this hypothesis, as we
show for the first time that miR-181b binds the
3’UTR of the ALX/FPR2 gene, thus regulating
ALX/FPR2 protein expression in human MФs (Figs.
3-4).
Notably,
monocyte
to
macrophage
differentiation was associated with significant
dowregulation of miR-181b expression, paralleled
by ALX/FPR2 upregulation (Fig. 5). This represents
an unappreciated aspect of the macrophage
differentiation program, which carries functional
consequences. Indeed, when the physiological
decrement in miR-181b expression during
macrophage differentiation was reversed by miR181b overexpression, the stimulation by ALX/FPR2
agonists of macrophage phagocytosis (key
proresolution mechanism) as well as the
downregulation of TNF-α release (proinflammatory
mediator) were suppressed (Fig. 7). Along these
lines, efferocytosis was accompanied by the drastic
reduction of miR-181 expression, whereas zymosan
potently upregulated it (Fig. 6), suggesting that
bacterial particles trigger distinct phagocytic
signaling in macrophages. This interesting aspect
requires further investigation. Collectively, these
results indicate that miR-181b can control
proresolution signals, triggered by ALX/FPR2
agonists, by regulating receptor expression,
although additional mechanisms cannot be
excluded. In this respect, it has to be pointed out that
this mechanism appears to be rather selective, since
miR-181b did not modify the expression of the
GPR32 receptor, which can be activated in human
leukocytes by LXA4 and RvD1 (15, 16, 33) and it is
not expressed in mouse cells (15). Therefore,
increased miR-181b levels in inflammatory
disorders may sustain disease development by
impairing resolution mechanisms. On the other
hand, the possibility that other miRs among those
listed in Table 1 may regulate ALX/FPR2
expression cannot be excluded. This should be
investigated in future studies.
As a conclusion, here we provide the first
evidence of a miR that regulates the expression of
the ALX/FPR2 receptor and, as a consequence, of
agonist-induced proresolution responses in human
macrophages. Together, these results uncover novel
regulatory mechanisms of ALX/FPR2 protein
expression, which could be exploited for innovative
approaches to inflammation-based diseases.
6
Downloaded from http://www.jbc.org/ by guest on December 29, 2014
the elucidation of mechanisms that control
ALX/FPR2 expression may provide useful
information for designing innovative strategies to
combat human disease with an inflammatory
background. In this respect, we have recently
uncovered a single nucleotide mutation (-220 A/G)
in the hALX/FPR2 core promoter of one patient
with history of acute cardiovascular events and of
his two daughters, both affected by arterial
hypertension and metabolic syndrome (29). This
mutation reduces promoter activity in vitro and it is
associated with strong inhibition of ALX/FPR2
expression in circulating PMN (29). Thus, it is
likely that a number of mechanisms concur to alter
ALX/FPR2 expression in disease, both at the
genetic and epigenetic level.
In the present report, we focused on microRNAs,
which are emerging as key tuners of genes related to
inflammation (41). To identify miR that may
regulate ALX/FPR2 expression, we employed a
“bottom up” method based on in silico prediction of
putative binding of mapped human miRs to the
3’UTR sequence of ALX/FPR2. This system avoids
time-consuming miR manipulation in cells by
forced expression or inhibition and subsequent
target validation. Using two bioinformatic tools,
TargetScan and microRNA.org, we found 27
miRNAs predicted to bind hALX/FPR2 3’UTR,
which represent ~ 1.4 % of annotated human
miRNA mature sequences (http://www.mirbase.org)
(42) (Fig. 1C). Among these, we selected miR-181b
for further analysis, mainly because of its
documented link with inflammation (45).
The human genome encompasses two miR-181b
genes (NCBI Entrez Gene MIR181B1 and
MIR181B2) located on chromosome 1 and 9. Both
genes encode for the same hairpin precursor and
mature sequence of 23 nt (42). mir-181b is highly
expressed in leukocytes, mainly of the lymphoid
lineage and is considered a biomarker of chronic
lymphocytic leukemia (38, 48, 49). Besides its
involvement in cancer, miR-181b has been
associated with inflammatory disorders. Increased
miR-181b levels have been detected in serum or
plasma from patients with liver cirrhosis (50, 51).
Moreover,
miR-181b
controls
chondrocyte
differentiation and maintains cartilage integrity,
being upregulated in chondrocytes isolated from the
cartilage of osteoarthritic patients (52). Increased
miR-181b levels were also denoted in periodontitis
gingivae (53). Along these lines, NF-kB regulation
by miR-181b has been reported (45). Notably, a
decrease in miR-181b following cerebral ischemic
injury in mouse is regarded as a neuroprotective
ALX/FPR2 regulation by miRNA-181b
REFERENCES
Downloaded from http://www.jbc.org/ by guest on December 29, 2014
1. Serhan, C. N., Brain, S. D., Buckley, C. D., Gilroy, D. W., Haslett, C., O'Neill, L. A., Perretti, M., Rossi,
A. G., and Wallace, J. L. (2007) Resolution of inflammation: state of the art, definitions and terms.
FASEB J. 21, 325-332.
2. Alessandri, A. L., Sousa, L. P., Lucas, C. D. Rossi, A. G., Pinho, V., and Teixeira, M. M. (2013)
Resolution of inflammation: mechanisms and opportunity for drug development. Pharmacol. Ther. 139,
189-212.
3. Shimizu, T. (2009) Lipid mediators in health and disease: enzymes and receptors as therapeutic targets
for the regulation of immunity and inflammation. Annu. Rev. Pharmacol. Toxicol. 49, 123-150.
4. Romano, M. (2010) Lipoxin and aspirin-triggered lipoxins. The Scientific World Journal 10, 1048-1064.
5. Serhan, C. N., Hamberg, M., and Samuelsson, B. (1984) Trihydroxytetraenes: a novel series of
compounds formed from arachidonic acid in human leukocytes. Biochem. Biophys. Res. Commun. 118,
943-949.
6. Levy, B. D., Clish, C. B., Schmidt, B. Gronert, K., and Serhan, C. N. (2001) Lipid mediator class
switching during acute inflammation: signals in resolution. Nat. Immunol. 2, 612-619.
7. Romano, M., Chen, X.S., Takahashi, Y.,Yamamoto, S., Funk, C.D., and Serhan, C.N.. (1993) Lipoxin
synthase activity of human platelet 12-lipoxygenase. Biochem. J. 296, 127-133.
8. Romano, M., Recchia, I., and Recchiuti, A. (2007) Lipoxin receptors. The Scientific World Journal 7,
1393-1412.
9. Maderna, P., and Godson, C. (2009) Lipoxins: resolutionary road. Br. J. Pharmacol. 158, 947-959.
10. Claria, J., and Serhan, C. N. (1995) Aspirin triggers previously undescribed bioactive eicosanoids by
human endothelial cell-leukocyte interactions. Proc. Natl. Acad. Sci. USA 92, 9475-9479.
11. Perretti, M., Chiang, N., La, M., Fierro, I. M., Marullo, S., Getting, S. J., Solito, E., and Serhan, C. N..
(2002) Endogenous lipid- and peptide-derived anti-inflammatory pathways generated with
glucocorticoid and aspirin treatment activate the lipoxin A4 receptor. Nature Med. 8, 1296-1302.
12. Morris, T., Stables, M., Hobbs, A., de Souza, P., Colville-Nash, P., Warner, T., Newson, J., Bellingan,
G., and Gilroy, D. W. (2009) Effects of low-dose aspirin on acute inflammatory responses in humans. J.
Immunol. 183, 2089-2096.
13. Fiore, S., Maddox, J. F., Perez, H. D., and Serhan, C. N. (1994) Identification of a human cDNA
encoding a functional high affinity lipoxin A4 receptor. J. Exp. Med. 180, 253-260.
14. Devchand, P. R., Arita, M., Hong, S., Bannenberg, G., Moussignac, R. L., Gronert, K., and Serhan, C. N.
(2003) Human ALX receptor regulates neutrophil recruitment in transgenic mice: roles in inflammation
and host defense. FASEB J. 17, 652-659.
15. Krishnamoorthy, S., Recchiuti, A., Chiang, N., Yacoubian, S., Lee, C. H., Yang, R., Petasis, N. A., and
Serhan, C. N. (2010) Resolvin D1 binds human phagocytes with evidence for proresolving receptors.
Proc. Natl. Acad. Sci. USA 107, 1660-1665.
16. Krishnamoorthy, S., Recchiuti, A., Chiang, N., Fredman, G., and Serhan, C. N. (2012) Resolvin D1
receptor stereoselectivity and regulation of inflammation and proresolving microRNAs. Am. J. Pathol.
180, 2018-2027.
17. Dufton, N., Hannon, R., Brancaleone, V., Dalli, J., Patel, H. B., Gray, M., D'Acquisto, F., Buckingham,
J. C., Perretti, M., and Flower, R. J. (2010) Anti-inflammatory role of the murine formyl-peptide
receptor 2: ligand-specific effects on leukocyte responses and experimental inflammation. J. Immunol.
184, 2611-2619.
18. Norling, L. V., Dalli, J., Flower, R. J., Serhan, C. N., and Perretti, M. (2012) Resolvin D1 limits
polymorphonuclear leukocyte recruitment to inflammatory loci: receptor-dependent actions.
Arterioscler. Thromb. Vasc. Biol. 32, 1970-1978.
19. Morris, T., Stables, M., Colville-Nash, P. Newson, J., Bellingan, G., de Souza, P. M., and Gilroy, D. W.
(2010) Dichotomy in duration and severity of acute inflammatory responses in humans arising from
differentially expressed proresolution pathways. Proc. Natl. Acad. Sci. USA 107, 8842-8847.
20. Levy, B. D., Bonnans, C., Silverman, E. S., Palmer, L. J., Marigowda, G., and Israel, E. (2005)
Diminished lipoxin biosynthesis in severe asthma. Am. J. Respir. Crit. Care Med. 172, 824-830.
21. Planaguma, A., Kazani, S., Marigowda, G. Haworth, O., Mariani, T. J., Israel, E., Bleecker, E. R.,
Curran-Everett, D., Erzurum, S. C., Calhoun, W. J., Castro, M., Chung, K. F., Gaston, B., Jarjour, N. N.,
7
ALX/FPR2 regulation by miRNA-181b
22.
23.
24.
25.
27.
28.
29.
30.
31.
32.
33.
34.
35.
36.
37.
8
Downloaded from http://www.jbc.org/ by guest on December 29, 2014
26.
Busse, W. W., Wenzel, S. E., and Levy, B. D. (2008) Airway lipoxin A4 generation and lipoxin A4
receptor expression are decreased in severe asthma. Am. J. Respir. Crit. Care Med. 178, 574-582.
Barnig, C., Cernadas, M., Dutile, S. Liu, X., Perrella, M. A., Kazani, S., Wechsler, M. E., Israel, E., and
Levy, B. D. (2013) Lipoxin A4 regulates natural killer cell and type 2 innate lymphoid cell activation in
asthma. Sci. Transl. Med. 5.
Karp, C. L., Flick, L. M., Park, K. W., Softic, S., Greer, T. M., Keledjian, R., Yang, R., Uddin, J.,
Guggino, W. B., Atabani, S. F., Belkaid, Y., Xu, Y., Whitsett, J. A., Accurso, F. J., Wills-Karp, M., and
Petasis, N. A. (2004) Defective lipoxin-mediated anti-inflammatory activity in the cystic fibrosis airway.
Nat. Immunol. 5, 388-392.
Bensalem, N., Ventura, A. P., Vallee, B., Lipecka, J., Tondelier, D., Davezac, N., Dos Santos, A.,
Perretti, M., Fajac, A., Sermet-Gaudelus, I., Renouil, M., Lesure, J. F., Halgand, F., Laprevote, O., and
Edelman, A. (2005) Down-regulation of the anti-inflammatory protein annexin A1 in cystic fibrosis
knock-out mice and patients. Mol. Cell. Proteomics 4, 1591-1601.
Mattoscio, D., Evangelista, V., De Cristofaro, R., Recchiuti, A., Pandolfi, A., Di Silvestre, S., Manarini,
S., Martelli, N., Rocca, B., Petrucci, G., Angelini, D. F., Battistini, L., Robuffo, I., Pensabene, T.,
Pieroni, L., Furnari, M. L., Pardo, F., Quattrucci, S., Lancellotti, S., Davi, G., and Romano, M. (2010)
Cystic fibrosis transmembrane conductance regulator (CFTR) expression in human platelets: impact on
mediators and mechanisms of the inflammatory response. FASEB J. 24, 3970-3980.
Ringholz, F. C., Buchanan, P. J., Clarke, D. T., Millar, R. G., McDermott, M., Linnane, B., Harvey, B.
J., McNally, P., and Urbach, V. (April 2, 2014) Reduced 15-lipoxygenase 2 and lipoxin A4/leukotriene
B4 ratio in children with cystic fibrosis. Eur. Respir. J./erj01060-2013.
Kosicka, A., Cunliffe, A. D., Mackenzie, R., Perretti, M., Flower, R. J., and Renshaw, D. (2013)
Attenuation of plasma annexin A1 in human obesity. FASEB J. 27, 368-378.
Ho, K. J., Spite, M., Owens, C. D., Lancero, H., Kroemer, A. H. K., Pande, R., Creager, M. A., Serhan,
C. N., and Conte, M. S. (2010) Aspirin-Triggered Lipoxin and Resolvin E1 Modulate Vascular Smooth
Muscle Phenotype and Correlate with Peripheral Atherosclerosis. Am. J. Pathol. 177, 2116-2123.
Simiele, F., Recchiuti, A., Mattoscio, D., De Luca, A., Cianci, E., Franchi, S., Gatta, V., Parolari, A.,
Werba, J. P., Camera, M., Favaloro, B., and Romano, M. (2012) Transcriptional regulation of the human
FPR2/ALX gene: evidence of a heritable genetic variant that impairs promoter activity. FASEB J. 26,
1323-1333.
Lee, R. C., Feinbaum, R. L., and Ambros, V. (1993) The C. elegans heterochronic gene lin-4 encodes
small RNAs with antisense complementarity to lin-14. Cell 75, 843-854.
Lau, N. C., Lim, L. P., Weinstein, E. G., and Bartel, D. P. (2001) An Abundant Class of Tiny RNAs
with Probable Regulatory Roles in Caenorhabditis elegans. Science 294, 858-862.
Baek, D., Villen, J., Shin, C., Camargo, F. D., Gygi, S. P., and Bartel, D. P. (2008) The impact of
microRNAs on protein output. Nature 455, 64-71.
Recchiuti, A., Krishnamoorthy, S., Fredman, G., Chiang, N., and Serhan, C. N. (2011) MicroRNAs in
resolution of acute inflammation: identification of novel resolvin D1-miRNA circuits. FASEB J. 25, 544560.
Fredman, G., Li, Y., Dalli, J., Chiang, N., Serhan, C.N. (2012) Self-limited versus delayed resolution of
acute inflammation: temporal regulation of pro-resolving mediators and microRNA. Sci Rep. 2, doi:
10.1038/srep00639
Li, Y., Dalli, J., Chiang, N., Baron, R.M., Quintana, C., Serhan C.N. (2013) Plasticity of leukocytic
exudates in resolving acute inflammation is regulated by MicroRNA and proresolving mediators.
Immunity 14, 885-98.
Sheedy, F. J., Palsson-McDermott, E., Hennessy, E. J., Martin, C., O'Leary, J. J., Ruan, Q., Johnson, D.
S., Chen, Y., and O'Neill, L. A. (2010) Negative regulation of TLR4 via targeting of the
proinflammatory tumor suppressor PDCD4 by the microRNA miR-21. Nat. Immunol. 11, 141-147.
Brennan, E. P., Nolan, K. A., Borgeson, Gough, O. S., McEvoy, C. M., Docherty, N. G., Higgins, D. F.,
Murphy, M., Sadlier, D. M., Ali-Shah, S. T., Guiry, P. J., Savage, D. A., Maxwell, A. P., Martin, F., and
Godson, C. (2013) Lipoxins attenuate renal fibrosis by inducing let-7c and suppressing TGFbetaR1. J.
Am. Soc. Nephrol. 24, 627-637.
ALX/FPR2 regulation by miRNA-181b
9
Downloaded from http://www.jbc.org/ by guest on December 29, 2014
38. Visone, R., Veronese, A., Rassenti, L. Z., Balatti, V., Pearl, D. K., Acunzo, M., Volinia, S., Taccioli, C.,
Kipps, T. J., and Croce, C. M. (2011) miR-181b is a biomarker of disease progression in chronic
lymphocytic leukemia. Blood 118, 3072-3079.
39. Livak, K. J., and Schmittgen, T. D. (2001) Analysis of relative gene expression data using real-time
quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 25, 402-408.
40. Recchiuti, A., Codagnone, M., Pierdomenico, A.M., Rossi C., Mari V.C., Cianci E., Simiele F., Gatta V.,
and Romano M. (April 1, 2014) Immunoresolving actions of oral resolvin D1 include selective
regulation of the transcription machinery in resolution-phase mouse macrophages. FASEB J./
10.1096/fj.13-248393.
41. Sheedy, F.J., and O'Neill, L.A. (2008) Ann. Rheum. Dis. Dec 67 Suppl 3:iii50-5.
42. Kozomara, A., and Griffiths-Jones, S. (2014) miRBase: annotating high confidence microRNAs using
deep sequencing data. Nucleic Acids Res. 42, D68-D73.
43. Iliopoulos, D., Jaeger, S. A., Hirsch, H. A., Bulyk, M. L., and Struhl, K. (2010) STAT3 activation of
miR-21 and miR-181b-1 via PTEN and CYLD are part of the epigenetic switch linking inflammation to
cancer. Mol. Cell. 39, 493-506.
44. Ma, X., Becker Buscaglia, L.E., Barker, J.R., and Li, Y. (2011) MicroRNAs in NF-kappaB signaling. J.
Mol. Cell. Biol. 3, 159-166.
45. Sun, X., Icli, B., Wara, A. K., Belkin, N., He, S., Kobzik, L., Hunninghake, G. M., Vera, M. P.,
Blackwell, T. S., Baron, R. M., and Feinberg, M. W. (2012) MicroRNA-181b regulates NF-kappaBmediated vascular inflammation. J. Clin. Invest. 122, 1973-1990.
46. Shi, Z.M., Wang, X.F., Qian, X., Tao, T., Wang, L., Chen, Q.D., Wang, X.R., Cao, L., Wang, Y.Y.,
Zhang, J.X., Jiang, T., Kang, C.S., Jiang, B.H., Liu, N., and You, Y.P. (2013) MiRNA-181b suppresses
IGF-1R and functions as a tumor suppressor gene in gliomas. RNA 19, 552-560.
47. Wu, S.H., Chen, X.Q., Liu, B., Wu, H.J., Dong, L. (2013) Efficacy and safety of 15(R/S)-methyl-lipoxin
A(4) in topical treatment of infantile eczema. Br. J. Dermatol. 168, 172-8.
48. Li, S., Moffett, H. F., Lu, J., Werner, L., Zhang, H., Ritz, J., Neuberg, D., Wucherpfennig, K. W.,
Brown, J. R., and Novina, C. D. (2011) MicroRNA expression profiling identifies activated B cell status
in chronic lymphocytic leukemia cells. PLoS One 6, e16956.
49. Visone, R., Veronese, A., Balatti, V., and Croce, C. M. (2012) MiR-181b: new perspective to
evaluate disease progression in chronic lymphocytic leukemia. Oncotarget 3, 195-202.
50. Wang, B., Li, W., Guo, K., Xiao, Y. Wang and Y. Fan, J. (2012) miR-181b promotes hepatic stellate
cells proliferation by targeting p27 and is elevated in the serum of cirrhosis patients. Biochem. Biophys.
Res. Commun. 421, 4-8.
51. Chen, Y.J., Zhu, J.M., Wu, H., Fan, J., Zhou, J., Hu, J., Yu, Q., Liu, T.T., Yang, L., Wu, C.L., Guo, X.L.,
Huang, X.W., and Shen, X.Z. (2013) Circulating microRNAs as a Fingerprint for Liver Cirrhosis. PLoS
One 8, e66577.
52. Song, J., Lee, M., Kim, D., Han, J., Chun, C.H., and Jin, E.J. (2013) MicroRNA-181b regulates articular
chondrocytes differentiation and cartilage integrity. Biochem. Biophys. Res. Commun. 431, 210-214.
53. Lee, Y.H., Na, H.S., Jeong, S.Y., Jeong, S.H., Park, H.R. and Chung, J. (2011) Comparison of
inflammatory microRNA expression in healthy and periodontitis tissues. Biocell. 35, 43-49.
54. Peng, Z., Li. J., Li, Y.,Yang, X,, Feng, S., Han, S., and Li, J. (2013) Downregulation of miR-181b in
mouse brain following ischemic stroke induces neuroprotection against ischemic injury through targeting
heat shock protein A5 and ubiquitin carboxyl-terminal hydrolase isozyme L1. J. Neurosci. Res. 91,
1349-1362.
ALX/FPR2 regulation by miRNA-181b
Acknowlegments- The authors thank Giuseppina Bologna, Sara Patruno, Roberto Plebani for technical
assistance and Rosa Visone for generously providing the mir-181b overexpression vector.
FOOTNOTES
*This work was supported in part by grants from the Italian Cystic Fibrosis Foundation (FFC#17/2012 and
FFC#19/2013) and from the Italian Ministry of the University and Research (PRIN 2010-2011) to MR.
1,3
To whom correspondence should be addressed: Center of Excellence on Aging “G. D’Annunzio”
University Foundation, Via Luigi Polacchi 13, 66013 Chieti, Italy, Phone and Fax: +39 0871541475, e-mail:
mromano@unich.it
4
Abbreviations used are: ALX/FPR2, Lipoxin A4 Receptor/Formyl Peptide Receptor 2; ANXA1,
glucocorticoid-induced annexin 1; ATL, Aspirin-triggered lipoxin; LXA4, Lipoxin A4 (5S, 6R,15Strihydroxy-7E,9E,11Z,13E-eicosatetraenoic
acid);
RvD1,
Resolvin
D1(7S,8R,17S-trihydroxy4Z,9E,11E,13Z,15E,19Z-docosahexaenoic acid).
FIGURE LEGENDS
FIGURE 2. Luciferase reporter assay. (A) Schematic representation of the reporter construct containing
the ALX/FPR2 3’ UTR (ALX-psiCHECK-2). (B) MDA-MB-231 cells were co-transfected with ALXpsiCHECK-2 plus TW empty vector or miR-181b-expressing TW vector (miR-181b-TW). The luciferase
activity was normalized for total proteins in cell lysates (mean ± SEM from n = 3 independent experiments
carried out in duplicate. *, P = 0.006)
FIGURE 3. Overexpression of mir-181b in human macrophages downregulates ALX/FPR2 protein
expression. (A) Relative abundance of miR-181b in MФs transfected with a miR-181b expression plasmid
(miR-181b-TW) or with an empty plasmid (TW). Expression levels of miR-181b were determined 24 h post
transfection. Data are mean ± SEM from n = 5 independent experiments carried out in duplicate. *, P = 0.03.
(B) ALX/FPR2 protein expression in MФs transfected with miR-181b-TW or mock-transfected (TW).
ALX/FPR2 expression was evaluated by flow cytometry 72 h after transfection. Bars represent mean ± SEM
of mean fluorescence intensity (M.F.I.) values from n = 5 independent experiments carried out in duplicate.
*, P = 0.0001. (C) ALX/FPR2 protein expression in MФs transfected with miR-181b-TW or mocktransfected (TW) in permeabilized (*, P = 0.016 vs TW) and non permeabilized cells (**, P = 0.0001 vs
TW).
FIGURE 4. Inhibition of mir-181b in human macrophages enhances ALX/FPR2 protein expression.
(A) Relative abundance of mir-181b 24 h post transfection of MФs with mir-181b inhibitor or control
plasmid. (mean ± SEM from n = 3 independent experiments carried out in duplicate. *, P = 0.004). (B)
ALX/FPR2 expression 48 h post transfection of MФs with mir-181b inhibitor (mean ± SEM from n = 3
independent experiments with duplicates. *, P = 0.0002). A representative histogram is shown in the right
panel. (C) See legend to panel A. Data are mean ± SEM from n = 3 independent experiments carried out in
duplicate. *, P = 0.0001). (D) GPR32 expression at 48 h and 72 h post transfection of macrophages with mir181b inhibitor (mean ± SEM from n = 3 independent experiments with duplicates).
FIGURE 5. Changes in miR-181b and ALX/FPR2 levels during human monocyte to macrophage
differentiation. Peripheral blood monocytes were differentiated into macrophages (MФs) by exposure to
human serum and GMCSF for 7 days. (A) miR-181b relative abundance in MФs was determined by real
time PCR (*, P = 0.048). (B) ALX/FPR2 protein expression was assessed by flow cytometry (*, P = 0.01). A
representative histogram is shown in the right panel. Data are from experiments with cells from 4 healthy
subjects carried out in duplicate.
10
Downloaded from http://www.jbc.org/ by guest on December 29, 2014
FIGURE 1. In silico analyses. (A) mir-181b is encoded by genes located on chromosome 1 and (B) on
chromosome 9. Conserved sequences complementary to ALX/FPR2 3’ UTR are in bold. (C) Predicted
binding of miR-181b sequences to a specific seed region within the ALX/FPR2 3’UTR.
ALX/FPR2 regulation by miRNA-181b
FIGURE 6. Apoptotic PMN and zymosan regulate miR-181b expression in human macrophages.
Relative abundance of mir-181b evaluated in MФs incubated for 24 h, 48 h, 72 h with apoptotic PMN (A) (*,
P = 0.011) or Zym (B) (*, P = 0.035).
FIGURE 7. miR-181b overexpression dampens antiinflammatory, proresolution responses of human
macrophages exposed to ALX/FPR2 endogenous agonists. MФs, transfected with either empty vector
(TW) or miR-181b expressing vector (miR-181b-TW) were exposed for 30 min to vehicle (A) or to
increasing concentrations of LXA4 (B) (*, P = 0.041, **, P = 0.036, ***, P = 0.033) or RvD1 (C) (*, P =
0.006, **, P = 0.0013). Phagocytosis of FITC-Zymosan was assessed by measuring fluorescence as in
Experimental procedures. Bars represent mean ± SEM of 4 independent experiments. (D) Human MФs were
transfected with miR-181b-TW or empty TW vector and exposed to Zym for 30 min at 37 °C. TNF-α levels
in the supernatants were determined by ELISA. Results are mean ± SEM from n = 3. (E) Cells were
processed as in D and exposed to increasing concentrations of RvD1 30 min before zymosan. TNF-α was
determined by ELISA. Results are expressed as % of vehicle control and are mean ± SEM from n = 3. *, P =
0.02, **, P = 0.004, ***, P = 0.0001.
Downloaded from http://www.jbc.org/ by guest on December 29, 2014
11
ALX/FPR2 regulation by miRNA-181b
TABLE 1. miRs predicted by both microrna.org and TargetScan Human to bind the 3’UTR of ALX/FPR2.
miRs predicted to bind the 3’UTR of ALX/FPR2.
hsa-miR-181b
.
hsa-miR-20b
hsa-miR-106a
hsa-miR-17
hsa-miR-374a
hsa-miR-374b
hsa-miR-519d
hsa-miR-93
hsa-miR-181c
hsa-miR-181a
Downloaded from http://www.jbc.org/ by guest on December 29, 2014
hsa-miR-375
hsa-miR-101
hsa-miR-139-5p
hsa-miR-335
hsa-miR-411
hsa-miR-410
hsa-miR-144
hsa-miR-20a
hsa-miR-106b
hsa-miR-212
hsa-miR-200a
hsa-miR-132
hsa-miR-141
hsa-miR-203
hsa-miR-433
hsa-miR-543
hsa-miR-181d
12
Figure 1
A
CCUGUGCAGAGAUUAUUUUUUA
AAAGGUCACAAUCAACAUUCAU
UGCUGUCGGUGGGUUGAACUG
UGUGGACAAGCUCACUGAACAA
UGAAUGCAACUGUGGCCCCGCU
U
B
Downloaded from http://www.jbc.org/ by guest on December 29, 2014
CUGAUGGCUGCACUCAACA
UUCAUUGCUGUCGGUGGGU
UUGAGUCUGAAUCAACUCA
CUGAUCAAUGAAUGCAAACU
GCGGACCAAACA
C
13
Figure 2
A
T7 promoter
hRluc
ALX/FPR2 3’ UTR
ALX-psiCHECK-2
1.2
1.0
0.8
0.6
*
0.4
0.2
0.0
ALX-psiCHECK-2
TW
miR-181b-TW
14
Downloaded from http://www.jbc.org/ by guest on December 29, 2014
Luciferase activity (R.L.U)
B
Figure 3
B
6
1.2
5
ALX/FPR2 (Fold M.F.I.)
*
4
3
2
1
0
1.0
0.8
*
0.6
0.4
0.2
0.0
TW
TW miR-181b-TW
mir-181b-TW
C
ALX/FPR2 (Fold M.F.I.)
1.2
1.0
*
0.8
**
0.6
0.4
0.2
0
TW
mir-181b-TW
mir-181b-TW
Permeabilized Non Permeabilized
15
Downloaded from http://www.jbc.org/ by guest on December 29, 2014
miR-181b (Relative Abundance)
A
Figure 4
B
ALX/FPR2 (Fold M.F.I.)
1.2
1.0
0.8
0.6
*
0.4
0.2
0.0
*
1.5
1.0
0.5
Control
mir-181b
inhibitor
D
1.2
1.2
1.0
1.0
0.8
0.6
0.4
*
0.2
0
Control
mir-181b
inhibitor
0.8
0.6
Control
miR-181b inhibitor
0.4
0.2
0
48h
16
72h
Downloaded from http://www.jbc.org/ by guest on December 29, 2014
mir-181b
inhibitor
C
miR-181b (Relative Abundance)
2.0
0.0
Control
GPR32 (Fold M.F.I.)
miR-181b (Relative Abundance)
A
Figure 5
B
0.1
*
60
*
0.06
0.04
0.02
ALX/FPR2 (M.F.I.)
55
0.08
50
45
40
35
30
25
0
20
Monocytes
MФs
Monocytes MФs
17
Downloaded from http://www.jbc.org/ by guest on December 29, 2014
miR-181b (Relative Abundance)
A
Figure 6
miR-181b (Relative Abundance)
A
1.4
1.2
CTRL
PMN
1.0
0.8
0.6
0.4
*
0.2
0
48
72
Time (h)
miR-181b (Relative Abundance)
B
35
30
CTRL
Zymosan
*
25
20
15
10
5
0
24
48
Time (h)
72
18
Downloaded from http://www.jbc.org/ by guest on December 29, 2014
24
Figure 7
A
D
0.7
TNF-α (pg/ml)
Zymosan Phagocytosis
(Arbitrary Units)
0.8
0.5
0.6
0.5
0.4
0.3
0.2
0.1
0
TW
0
miR-181b-TW
miR-181b-TW
140
TW
120
TNF-α release (% of control)
Zymosan Phagocytosis (% of control)
E
miR-181b
100
80
60
**
*
40
20
***
0
0.1
-­‐20
1
10
350
TW
miR-181b
300
250
200
150
100
50
0
-50
LXA4 [nM]
-100
C
Zymosan Phagocytosis (% of control)
400
**
0.01
***
0.1
RvD1 [nM]
80
60
TW
miR-181b
40
20
0
-20
-40
0.01
**
0.1
1*
10
RvD1 [nM]
19
*
10
Downloaded from http://www.jbc.org/ by guest on December 29, 2014
B
TW
1/--pages
Report inappropriate content